Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: SDS Page, Transfection, Construct, Two Tailed Test

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: IP 3 R3-knockout DLD1 cell line, DLD1/IP 3 R3_del, was established using the CRISPR/Cas9 gene editing method. The IP 3 R3 protein knockout in DLD1/IP 3 R3_del cells was confirmed by immunofluorescence ( a ) and also by Western blot analysis ( b ) using anti-IP 3 R3 antibody. Either DLD1, or DLD1/IP 3 R3_del cells were subcutaneously injected into the lower flank of the nude mice and growth of tumors was compared ( c ). After 12 days, tumors were extirpated ( c ) and relative volumes were significantly lower from DLD1/IP 3 R3_del cells compared to DLD1 cells ( d ). Western blot analysis revealed increased expression of the IP 3 R1 in tumors from DLD1/IP 3 R3_del cells compared to DLD1 cells ( e ), while no expression of the IP 3 R3 was observed in tumors induced by DLD1/IP 3 R3_del cells ( f ). Apoptosis was determined in tumor slices by TUNEL assay ( g ), and differenced in morphology are shown by hematoxylin/eosin staining (HaE; g , bottom). NC negative control. In graphs, results are displayed as mean ± SEM, n = 6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Knock-Out, CRISPR, Immunofluorescence, Western Blot, Injection, Expressing, TUNEL Assay, Staining, Negative Control

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: Apoptosis induction in DLD1 and DLD1/IP 3 R3_del cells after silencing of the IP 3 R1 and subsequent induction of apoptosis by AIK ( a ). Silencing of the IP 3 R1 decreased the basal apoptosis compared to cells treated with scrRNA in both, DLD1 and DLD1/IP 3 R3_del cells. After treatment with AIK, apoptosis was significantly higher in DLD1/IP 3 R3_del than in DLD1 cells. In DLD1 cells, we observed co-localization of IP 3 R1 and IP 3 R3 by proximity ligation assay ( b ). Scale bar represents 25 μm. Silencing of the IP 3 R1 and/or IP 3 R3 revealed a decrease in levels of cytosolic calcium in RCC4, A2780 and DLD1 cells ( c ). Interestingly, the increase in cytosolic calcium after AIK treatment was not as high as in cells treated with scrambled RNA ( c ). Double knockout of IP 3 R1/IP 3 R3 completely abolished apoptosis induction ( d ). Further, we compared apoptosis induction ( e ) in DLD1 and DLD1/IP 3 R3_del cells after 24 and 48 h hypoxia induced by DMOG. Depletion of the IP 3 R3 resulted in rapid increase of apoptosis both, in normoxia and hypoxia. On contrary to DLD1 cells, this increase was not dependent on duration of hypoxia ( e ) in DLD1/IP 3 R3_del cells, but the level of the apoptosis was higher in normoxic and 24 h hypoxia group compared to DLD1 cells. Scale bar represents 300 μm. Results are displayed as mean ± SEM, n = 3–6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Proximity Ligation Assay, Double Knockout

Journal: Oncogene

Article Title: Cyclin D-CDK4 relieves cooperative repression of proliferation and cell cycle gene expression by DREAM and RB.

doi: 10.1038/s41388-019-0767-9

Figure Lengend Snippet: (A) HFFs were split into media with palbociclib and BrdU incorporation was measured in cells harvested after 24 hours (3 bio rep). Student’s T test was calculated compared to 0 nM. (B) 200 nM palbociclib was added at times after split and BrdU incorporation was measured in cells harvested at 24 hours post split (2 bio rep). Student’s T-test was calculated compared to 0 hr. (C) HFFs were split into palbociclib and harvested at indicated times and analyzed by immunoblot. * indicates nonspecific band. (D) Parental HFFs were transduced with pLenti-E1Fa-CDK4 WT, K35M, and I12A and contact arrested before harvested for immunoblot. Arrow indicates on-target band. (E) CDK4 expressing HFFs were released from contact arrest into palbociclib and harvested after 24 hours and analyzed by immunoblot. (F) CDK4 expressing HFFs were released from contact arrest into palbociclib and transcript level of CDC6 and MCM5 was measured by RT-qPCR (3 bio rep). Student’s T-test was calculated by comparing to 0 nM. (G) CDK4 expressing HFFs were released from contact arrest into palbociclib and S phase was measured by BrdU incorporation after 24 hours. Statistics comparing curves was completed by two-way ANOVA (3 bio rep). P values are indicated as * for <0.05, and ** for <0.01, *** for <0.001. See also .

Article Snippet: To determine if palbociclib-mediated inhibition of cell cycle progression was dependent on CDK4 activity in HFFs, we utilized a mutant allele of CDK4 (I12A) that is partially resistant to palbociclib (personal communication, Nicole Persky and Cory Johannessen, Broad Institute).

Techniques: BrdU Incorporation Assay, Western Blot, Transduction, Expressing, Quantitative RT-PCR