Journal: JCO Precision Oncology

Article Title: Genomic Resistance Patterns to Second-Generation Androgen Blockade in Paired Tumor Biopsies of Metastatic Castration-Resistant Prostate Cancer

doi: 10.1200/PO.17.00140

Figure Lengend Snippet: CDK overexpression is sufficient to drive enzalutamide resistance. (A) Schematic diagram of engineering CDK4/6 -overexpressing LnCAP cells and the subsequent experimental determination of enzalutamide sensitivity. (B) CDK4/6 -overexpressing androgen-sensitive LnCAP cells continue to proliferate when cultured in androgen-free media (charcoal-stripped serum [CSS]) and enzalutamide 2.5 μM. The same treatment negatively impacted luciferase control–expressing LnCAP cells. The resistant phenotype was ablated when additional CDK4/6 inhibitors, palbociclib or ribociclib, were supplemented with androgen-deprivation and enzalutamide treatment. The average of three experiments is plotted and error bars represent standard deviation. (*) Overexpression of a gene led to a significant difference compared with luciferase control cells. (†) Cell-cycle inhibitor treatment led to a significant reduction of proliferation ( P < .005, two-tailed t test).

Article Snippet: Broad Institute Genomic Perturbation Platform protocols ( http://portals.broadinstitute.org/gpp/public/resources/protocols ) were followed to produce lentiviruses particles that contained open reading frames of CDK4 (TRCN0000473179), CDK6 (TRCN0000488331), or luciferase control (cloned into pLX307 plasmid).

Techniques: Over Expression, Cell Culture, Luciferase, Control, Expressing, Standard Deviation, Two Tailed Test

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: IP 3 R3-knockout DLD1 cell line, DLD1/IP 3 R3_del, was established using the CRISPR/Cas9 gene editing method. The IP 3 R3 protein knockout in DLD1/IP 3 R3_del cells was confirmed by immunofluorescence ( a ) and also by Western blot analysis ( b ) using anti-IP 3 R3 antibody. Either DLD1, or DLD1/IP 3 R3_del cells were subcutaneously injected into the lower flank of the nude mice and growth of tumors was compared ( c ). After 12 days, tumors were extirpated ( c ) and relative volumes were significantly lower from DLD1/IP 3 R3_del cells compared to DLD1 cells ( d ). Western blot analysis revealed increased expression of the IP 3 R1 in tumors from DLD1/IP 3 R3_del cells compared to DLD1 cells ( e ), while no expression of the IP 3 R3 was observed in tumors induced by DLD1/IP 3 R3_del cells ( f ). Apoptosis was determined in tumor slices by TUNEL assay ( g ), and differenced in morphology are shown by hematoxylin/eosin staining (HaE; g , bottom). NC negative control. In graphs, results are displayed as mean ± SEM, n = 6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Knock-Out, CRISPR, Immunofluorescence, Western Blot, Injection, Expressing, TUNEL Assay, Staining, Negative Control

Journal: Cell Death & Disease

Article Title: Type 3 inositol 1,4,5-trisphosphate receptor has antiapoptotic and proliferative role in cancer cells

doi: 10.1038/s41419-019-1433-4

Figure Lengend Snippet: Apoptosis induction in DLD1 and DLD1/IP 3 R3_del cells after silencing of the IP 3 R1 and subsequent induction of apoptosis by AIK ( a ). Silencing of the IP 3 R1 decreased the basal apoptosis compared to cells treated with scrRNA in both, DLD1 and DLD1/IP 3 R3_del cells. After treatment with AIK, apoptosis was significantly higher in DLD1/IP 3 R3_del than in DLD1 cells. In DLD1 cells, we observed co-localization of IP 3 R1 and IP 3 R3 by proximity ligation assay ( b ). Scale bar represents 25 μm. Silencing of the IP 3 R1 and/or IP 3 R3 revealed a decrease in levels of cytosolic calcium in RCC4, A2780 and DLD1 cells ( c ). Interestingly, the increase in cytosolic calcium after AIK treatment was not as high as in cells treated with scrambled RNA ( c ). Double knockout of IP 3 R1/IP 3 R3 completely abolished apoptosis induction ( d ). Further, we compared apoptosis induction ( e ) in DLD1 and DLD1/IP 3 R3_del cells after 24 and 48 h hypoxia induced by DMOG. Depletion of the IP 3 R3 resulted in rapid increase of apoptosis both, in normoxia and hypoxia. On contrary to DLD1 cells, this increase was not dependent on duration of hypoxia ( e ) in DLD1/IP 3 R3_del cells, but the level of the apoptosis was higher in normoxic and 24 h hypoxia group compared to DLD1 cells. Scale bar represents 300 μm. Results are displayed as mean ± SEM, n = 3–6. Statistical significance * p < 0.05, ** p < 0.001, and *** p < 0.0001

Article Snippet: The IP 3 R3 CRISPR guide RNA sequences (GTGCCCCATGAACCGCTACT and TACGAGCTCAGCGACAACGC) were designed by the laboratory of Feng Zhang at the Broad Institute in order to efficiently target the IP 3 R3 gene with minimal risk of off-target Cas9 binding elsewhere in the genome , .

Techniques: Proximity Ligation Assay, Double Knockout

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: Ultrastructural alteration of lysosomal structures and elevated autophagy in Vps35 KO cells. (A) Generation of CRISPR/Cas9-mediated Vps35 KO HeLa cells and Vps35-GFP rescue cells. Equal amounts of cell lysates from HeLa, Vps35 KO, and Vps35-GFP rescue cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, Vps29, and tubulin. (B) Electron micrographs of HeLa, Vps35 KO, and Vps35-GFP rescue cells. Enlarged circular structures are indicated as late endosomal/lysosomal structures. Scale bars, 2,000 nm; in zoomed images, 500 nm. Graph represents the percentage volume density of lysosomal compartments relative to the cytoplasm in HeLa, Vps35 KO, and Vps35-GFP rescue cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance. **, P < 0.01; ***, P < 0.001. n = two independent experiments with 10 images each. (C) Flow cytometric analysis of cellular acidification based on LysoTracker fluorescence in HeLa and Vps35 KO cells. Graph represents the mean fluorescent intensity within HeLa and Vps35 KO cells (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). (D) HeLa, Vps35 KO, and Vps35-GFP rescue cells were fixed and coimmunolabeled with antibodies against LC3-II and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies. Scale bars, 5 µm. The colocalization between LC3-II and LAMP1 was quantified by the Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance among HeLa, Vps35 KO, and Vps35-GFP rescue cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (E) HeLa and Vps35 KO cells were treated with chloroquine (CQ, 50 µM) for 6 h. Cells were harvested, and equal amounts of protein samples were used for SDS-PAGE and immunoblotting with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05; **, P < 0.01. (F) Amino acid–starved HeLa, Vps35 KO, and Vps35-GFP rescue cells were treated with 2× essential amino acid solution for 30 min, fixed with ice-cold methanol, and coimmunolabeled with antibodies against mTORC1 and LAMP1, followed by Alexa Fluor–conjugated fluorescent secondary antibodies (means ± SEM). Scale bars, 5 µm. The colocalization of mTORC1 with LAMP1 was quantified by Pearson’s correlation coefficient. Two-tailed Student’s t test indicates the difference between HeLa and Vps35 KO cells upon amino acid stimulation ( n = 3). ***, P < 0.001; ****, P < 0.0001. (G) HeLa and Vps35 KO cells were treated with AZD8055 (1 µM) for 25 h before being subjected to SDS-PAGE and immunoblotted with antibodies against LC3-II, Vps35, and GAPDH. Graph represents the expression level of LC3-II normalized to GAPDH (mean ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). *, P < 0.05.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: CRISPR, SDS Page, Two Tailed Test, Fluorescence, Western Blot, Expressing

Journal: The Journal of Cell Biology

Article Title: Retromer has a selective function in cargo sorting via endosome transport carriers

doi: 10.1083/jcb.201806153

Figure Lengend Snippet: SNX3 is required for the retrograde transport of CI-M6PR GCC88-tethered ETCs. (A) Equal amounts of cell lysates from HeLa, SNX1/2 dKO, SNX3 KO, and SNX27 KO cells were subjected to SDS-PAGE and immunoblotted with antibodies against Vps35, Vps26A, SNX1, SNX2, SNX5, SNX6, SNX27, SNX3, and tubulin. (B and C) HeLa, SNX3 KO, SNX1/2 dKO, and SNX27 cells were transiently transfected with HA-tagged mitochondria-targeting golgin constructs GCC88-MAO, Golgin-97-MAO, Golgin-245-MAO, or GM130-MAO; fixed; and coimmunolabeled with antibodies against HA and endogenous CI-M6PR (B) or CD-M6PR (C), followed by Alexa Fluor–conjugated secondary antibodies. The intensity plots of the fluorescent intensity (y-axis) against distance (x-axis) represent the overlap between channels. The colocalization of CI-M6PR (B) or CD-M6PR (C) with HA-tagged golgin-mito proteins was quantified by Pearson’s correlation coefficient (means ± SEM). Two-tailed Student’s t test was used to determine the statistical significance ( n = 3). **, P < 0.01; ****, P < 0.0001.

Article Snippet: The SNX3 CRISPR guide RNA (gRNA) plasmid (gRNA targeting sequence: 5′-CGGCCGACCCCCACCGTTTG-3′), SNX1 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-AAATCATCCTACCATGTTAC-3′), and the SNX2 CRISPR gRNA plasmid (gRNA targeting sequence: 5′-TGATGGCATGAATGCCTATA-3′) were synthesized by Genscript.

Techniques: SDS Page, Transfection, Construct, Two Tailed Test

Journal: Nature Communications

Article Title: Epigenetic regulation of CD38/CD48 by KDM6A mediates NK cell response in multiple myeloma

doi: 10.1038/s41467-024-45561-z

Figure Lengend Snippet: a Schematic of genome-wide CRISPR screen in a MM cell line treated with Dara and human primary NK cells. b Top genes for enriched (red) and depleted (blue) sgRNAs from the screen. Candidate genes were plotted based on the beta score, computed by MaGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) of sgRNAs normalized to control. c Schematic of the CRISPR assay to identify essential genes for Dara-NK-mediated ADCC. d TCGA RNA-seq data from 36 human cancer types were analyzed to obtain genes positively correlated with cytolytic (CYT) activity. The number of overlapped genes between our top candidates and CYT activity-related genes was quantified in each cancer type. e Heatmap showing the partitioning of the clusters of genes based on Pearson’s correlation coefficient values of CRISPR screen hits with CYT activity using pan-cancer TCGA data. Figure 1c was created with BioRender.com.

Article Snippet: CRISPR screen sequencing data, RNA-seq, ChIP-seq and ATAC-seq data generated in this study are deposited in the National Institute of Health Gene Expression Omnibus (GEO) database ( GSE228771 ). are provided with this paper.

Techniques: Genome Wide, CRISPR, Knock-Out, Control, RNA Sequencing, Activity Assay

Journal: Nature Communications

Article Title: Epigenetic regulation of CD38/CD48 by KDM6A mediates NK cell response in multiple myeloma

doi: 10.1038/s41467-024-45561-z

Figure Lengend Snippet: a Schematic of the second genome-wide CRISPR screen in a MM cell line. Five percent of cells with the lowest expression of CD38 were collected for next-generation sequencing. b Top genes for enriched (red) and depleted (blue) gRNAs from the screen. c Venn diagram showing the overlapped enriched genes between the two CRISPR screens. d Western blot of CD38 protein levels in MM cell lines with CRISPR-mediated knock (KO) of KDM6A . e q-RT-PCR for CD38 mRNA in MM cell lines transfected with indicated sgRNAs. Data were normalized against GAPDH (mean ± SEM, n = 3 biologically independent experiments). *** p < 0.001; **** p < 0.0001 (two-sided student’s t test). f Representa t ive flow cytometry analysis of CD38 expression in H929 single clones transfected with indicated sgRNAs. g Western blotting of CD38 protein levels after ectopic overexpression of KDM6A in KDM6A -KO H929 cells. OE, overexpression. Three independent experiments were performed and similar results were obtained. h Representative flow cytometry analysis of CD38 expression level after ectopic overexpression of KDM6A in KDM6A -KO H929 cells. Source data are provided as a Source Data file.

Article Snippet: CRISPR screen sequencing data, RNA-seq, ChIP-seq and ATAC-seq data generated in this study are deposited in the National Institute of Health Gene Expression Omnibus (GEO) database ( GSE228771 ). are provided with this paper.

Techniques: Genome Wide, CRISPR, Expressing, Next-Generation Sequencing, Western Blot, Reverse Transcription Polymerase Chain Reaction, Transfection, Flow Cytometry, Clone Assay, Over Expression

Journal: Nature Communications

Article Title: Epigenetic regulation of CD38/CD48 by KDM6A mediates NK cell response in multiple myeloma

doi: 10.1038/s41467-024-45561-z

Figure Lengend Snippet: a Normalized lysis percentage of KDM6A WT or KO H929 cells after co-culture with primary NK cells at different E:T ratios with IL-2 for 6 hours (mean ± SEM, n = 3 biologically independent experiments). * p < 0.05; ** p < 0.01; *** p < 0.001 (two-sided student’s t test). b Intracellular IFN-γ s t aining of primary NK cells co-cultured with KDM6A WT or KO H929 cells with IL-2 for 6 hours (mean ± SEM, n = 3 biologically independent experiments). ** p < 0.01 (two-sided student’s t test). c Volcano plot of differentially expressed genes in KDM6A KO H929 cells compared with WT cells assessed by RNA-seq. d Venn diagram showing the overlapped enriched genes between the CRISPR screen and RNA-seq. e , Representative flow cytometry analysis of CD48 expression in H929 transfected with indicated sgRNAs. f q-RT-PCR for CD48 mRNA in H929 cells transfected with indicated sgRNAs. Data were normalized against GAPDH (mean ± SEM, n = 3 biologically independent experiments). **** p < 0.0001 (two-sided student’s t test). g , ChIP-seq density profiles for H3K27me3 on t he CD48 gene in KDM6A WT and KO H929 cells. h , H3K27me3 ChIP-qPCR analysis at the CD48 gene in KDM6A WT and KO H929 cells (mean ± SEM, n = 3 biologically independent experiments). *** p < 0.001 (two-sided student’s t test). i , ATAC-seq density profiles at the CD48 promoter region in KDM6A WT and KO H929 cells. j q-RT-PCR for CD48 mRNA in newly diagnosed (N/D) ( n = 7) and Dara-resistant (R/R) ( n = 12) patient samples. Data were normalized against GAPDH (mean ± SEM). * p < 0.05 (two-sided student’s t test). Source data are provided as a Source Data file.

Article Snippet: CRISPR screen sequencing data, RNA-seq, ChIP-seq and ATAC-seq data generated in this study are deposited in the National Institute of Health Gene Expression Omnibus (GEO) database ( GSE228771 ). are provided with this paper.

Techniques: Lysis, Co-Culture Assay, Cell Culture, RNA Sequencing, CRISPR, Flow Cytometry, Expressing, Transfection, Reverse Transcription Polymerase Chain Reaction, ChIP-sequencing, ChIP-qPCR